## ----setup, include = FALSE--------------------------------------------------- knitr::opts_chunk$set( collapse = TRUE, comment = "#>" ) library(stringmagic) ## ----------------------------------------------------------------------------- # 'Split' with its default (comma separation) string_magic("{Split ! romeo, juliet}") # result with 's' is different string_magic("{split ! romeo, juliet}") # with argument: 's' and 'S' are identical # note the flag 'fixed' (`f/`) to remove regex interpretation string_magic("{'f/+'split, '-'collapse ! 5 + 2} = 3") # group wise operations (here `~(sort, collapse)`, see dedicated section) prince_talk = c("O that this too too solid flesh would melt", "Thaw, and resolve itself into a dew!", "Or that the Everlasting had not fix'd", "His canon 'gainst self-slaughter!") cat_magic("Order matters:\n{split, ~(sort, collapse), align.center, lower, upper.sentence, Q, '\n'collapse ? prince_talk}") ## ----------------------------------------------------------------------------- # regular way x = 1:4 string_magic("And {' and 'collapse ? x}!") # with s2 string_magic("Choose: {', | or 'collapse ? 2:4}?") # default of Collapse: enumeration (similar to operation enum) wines = c("Saint-Estephe", "Margaux") string_magic("I like {Collapse ? wines}.") # default of collapse: space concatenation string_magic("{split, '.{5,}'get, collapse ! I don't like short words}") ## ----------------------------------------------------------------------------- x = c("margo: 32, 1m75", "luke doe: 27, 1m71") string_magic("{'^\\w+'extract ? x} is {'\\d+'extract.first ? x}") # illustrating multiple extractions # group-wise operation (~()) is detailed in its own section x = c("Combien de marins, combien de capitaines.", "Qui sont partis joyeux pour des courses lointaines,", "Dans ce morne horizon se sont évanouis !") string_magic("Endings with i: {'i\\w*'extract, ~(', 'collapse), enum.1 ? x}.") x = c("6 feet under", "mahogany") # single extraction string_magic("{'\\w{3}'x ? x}") # multiple extraction string_magic("{'\\w{3}'X ? x}") ## ----------------------------------------------------------------------------- # regex without replacement (ie removing) string_magic("{'e'replace ! Where is the letter e?}") # regex with replacement string_magic("{'(?<!\\b)e => a'replace ! Where is the letter e?}") # with option "single" string_magic("{'single/(?<!\\b)e => a'replace ! Where is the letter e?}") # we replace the full string with the flag total (`t/`) x = c("Where is the letter e?", "Not this way!") string_magic("{'total/e => here!'r ? x}") ## ----------------------------------------------------------------------------- # we use the fixed pattern to remove the regex meaning string_magic("{'f/[, ]'clean ! x[a]}") ## ----------------------------------------------------------------------------- x = row.names(mtcars) # we only keep models containing "Merc" and ending with a letter ([[:alpha:]]$) string_magic("Mercedes models: {'Merc & [[:alpha:]]$'get, '^.+ 'r, enum ? x}.") models = c("Merc 230", "Merc 450SE", "Merc 480") # we only ekep the ones in the set string_magic("Mercedes models: {`models`get.in, enum ? x}.") ## ----------------------------------------------------------------------------- x = c("Mark", "Lucas") # note that we use the flag `i/` to ignore the case string_magic("Mark? {'i/mark'is, enum ? x}") ## ----------------------------------------------------------------------------- x = c("Mark", "Lucas", "Markus") # note that we use the flag `i` to ignore the case and `w` to add word boundaries string_magic("Mark is number {'iw/mark'which ? x}.") ## ----------------------------------------------------------------------------- string_magic("First 3 mpg values: {3 first, enum ? mtcars$mpg}.") # you could have done the same with regular R in the expression... string_magic("First 3 mpg values: {enum ? head(mtcars$mpg, 3)}.") # ...but not in the middle of an operations chain string_magic("First 3 integer mpg values: {'f/!.'get, 3 first, enum ? mtcars$mpg}.") ## ----------------------------------------------------------------------------- string_magic("Letters in the middle: {13 first, 5 last, enum ? letters}.") string_magic("First and last letters: {'3|3'first, enum ? letters}.") string_magic("Last letters: {-21 first, enum ? letters}.") ## ----------------------------------------------------------------------------- # basic use string_magic("First 3 letters: {'3'K, q, enum ? letters}.") # advanced use: using the extra argument string_magic("The letters are: {q, '3|:rest: others'K, enum ? letters}.") ## ----------------------------------------------------------------------------- string_magic("Last 3 mpg values: {3 last, enum ? mtcars$mpg}.") string_magic("Removing the 3 last elements leads to {-3 last, enum ! x{1:5}}.") ## ----------------------------------------------------------------------------- x = c("sort", "me") # basic use string_magic("{sort, collapse ? x}") ## ----------------------------------------------------------------------------- # first modifying the string before sorting # here the regex first removes the first word, meaning that we sort on the last names x = c("Jon Snow", "Khal Drogo") string_magic("{'.+ 'sort, enum?x}") ## ----------------------------------------------------------------------------- x = "Mark is 34, Bianca is 55, Odette is 101, Julie is 21 and Frank is 5" # sort on the "character string" number string_magic("{', | and 'split, '\\D'sort, enum ? x}") # we extract the numbers, then convert to numeric, then sort string_magic("{', | and 'split, '\\D'sort.num, enum ? x}") ## ----------------------------------------------------------------------------- # note the difference x = c(20, 100, 10) # sorting on numeric string_magic("{sort, ' + 'collapse ? x}") # sorting on character since 'n' operation transformed the vector to character string_magic("{n, sort, ' + 'collapse ? x}") ## ----------------------------------------------------------------------------- string_magic("5 = {dsort, ' + 'collapse ? 2:3}") ## ----------------------------------------------------------------------------- string_magic("{rev, ''collapse ? 1:3}") ## ----------------------------------------------------------------------------- string_magic("Iris species: {unik, upper.first, enum ? iris$Species}.") ## ----------------------------------------------------------------------------- dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "") cat_magic("Letters in the DNA seq. {''c, Q? dna}: ", " - default: {table, enum ? dna}", " - value sorted: {table.sort, enum ? dna}", " - shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}", # `fsort` sorts by **increasing** frequency " - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}", .sep = "\n") ## ----------------------------------------------------------------------------- # note: operation `S` splits splits wrt to commas (default behavior) string_magic("{S!x, y}{2 each ? 1:2}") # illustrating collapsing string_magic("Large number: 1{5 each.c ! 0}") ## ----------------------------------------------------------------------------- string_magic("What{6 times.c ! ?}") ## ----------------------------------------------------------------------------- x = c("Luke", "Charles") string_magic("{'i/lu'rm ? x}") ## ----------------------------------------------------------------------------- x = c("I want to enter.", "Age?", "21.") string_magic("Nightclub conversation: {rm.noalpha, c ! - {x}}") ## ----------------------------------------------------------------------------- x = c(5, 7, 453, 647) # here we use a condition: see the dedicated section for more information string_magic("Small numbers only: {if(.>20 ; nuke), enum ? x}.") ## ----------------------------------------------------------------------------- string_magic("{'3'insert.right, ' + 'collapse ? 1:2}") ## ----------------------------------------------------------------------------- fml = y ~ x1 + x2 string_magic("The estimated model is {dp ? fml}.") string_magic("The estimated model is {10 dp ? fml}.") ## ----------------------------------------------------------------------------- x = "MesSeD uP CaSe" string_magic("from a {x} to {lower?x}") ## ----------------------------------------------------------------------------- x = "hi. how are you? fine." string_magic("{upper.sentence ? x}") ## ----------------------------------------------------------------------------- x = "bryan is in the KITCHEN" # default: respects upper cases string_magic("{title ? x}") # force: force to title case string_magic("{title.force ? x}") # ignore: ignores small prepositions string_magic("{title.force.ignore ? x}") ## ----------------------------------------------------------------------------- x = " I should? review 85 4 this text!!" cat_magic("v0: {x}", "v1: {ws ? x}", "v2: {ws.punct ? x}", "v3: {ws.punct.digit ? x}", "v4: {ws.punct.digit.isolated ? x}", .sep = "\n") ## ----------------------------------------------------------------------------- x = " too much space \t\n" string_magic("With trim: {tws, Q ? x}") ## ----------------------------------------------------------------------------- x = c("Mark", "Pam") string_magic("Hello {q, enum ? x}!") ## ----------------------------------------------------------------------------- x = c(1, 12345) cat_magic("left : {format, q, enum ? x}", "right : {Format, q, enum ? x}", "center: {format.center, q, enum ? x}", "zero : {format.0, q, enum ? x}", .sep = "\n") ## ----------------------------------------------------------------------------- string_magic("pi = {%.3f ? pi}") ## ----------------------------------------------------------------------------- x = c("He is tall", "He isn't young") string_magic("Is he {stop, ws, enum ? x}?") ## ----------------------------------------------------------------------------- author = "Laurent Bergé" string_magic("This package has been developped by {ascii ? author}.") ## ----------------------------------------------------------------------------- # rounding at 2 digits cat_magic("pi = {r2 ? pi}\n", # same as above with a different syntax "pi = {round.2 ? pi}") x = c(153, 207.256, 0.00254, 15231312.2) # keeping one significant digit cat_magic("v1: {s1, align ? x} ", # removing the comma for large numbers and preserving ints "v2: {s1.int.nocomma ? x}", .collapse = "\n") # combining signif with round y = c(pi, 0.00125) cat_magic("raw: {align ? y} ", "s1: {s1, align ? y} ", "r2: {r2, align ? y} ", "s1.r2: {s1.r2 ? y}", .collapse = "\n") # prefix and prefix: use and argument z = c(55, 22.5, 21) cat_magic("Costs in euros : {' €'r1, enum ? z}.", "\nCosts in dollars: {'USD |'r1, enum ? z}.") # non numeric values are preserved xraw = c("55", "five") string_magic("Valuess {r1, enum ? xraw}.") # use the `num` command for more control string_magic("Values: {num.rm, r1, enum ? xraw}.") ## ----------------------------------------------------------------------------- x = c(5, 12, 52123) string_magic("She owes {n, '$'paste, enum ? x}.") # option 0: all same width, no ',' for thousands cat_magic("|---|\n{n.0, '\n'collapse ? x}") # option "upper" n = 5 string_magic("{n.upper ? n} is my favourite number.") # N: like "n.letter" x = 5 string_magic("He's {N ? x} years old.") # roman string_magic("What's nicer? {collapse?11:13}, {n.roman, c?11:13} or {n.Roman, c?11:13}?") ## ----------------------------------------------------------------------------- n = c(3, 7) string_magic("They finished {nth, enum ? n}!") ## ----------------------------------------------------------------------------- string_magic("They arrived {nth.compact ? 5:20}.") ## ----------------------------------------------------------------------------- n = c(3, 7) string_magic("They finished {Nth, enum ? n}!") ## ----------------------------------------------------------------------------- string_magic("They lost {enum ! {ntimes ? c(1, 12)} against {S!Real, Barcelona}}.") ## ----------------------------------------------------------------------------- x = 5 string_magic("This paper was rejected {Ntimes ? x}...") ## ----------------------------------------------------------------------------- string_magic("{19 firstchar, 9 lastchar ! This is a very long sentence}") string_magic("delete 3 = {-3 firstchar ! delete 3}") ## ----------------------------------------------------------------------------- x = "long sentence" cat_magic("v0: {x}", "v1: {4 shorten ? x}", "v2: {'4|..'shorten ? x}", "v3: {'4|..'shorten.include ? x}", "v4: {4 shorten.dots ? x}", .sep = "\n") ## ----------------------------------------------------------------------------- life = "full of sound and fury, Signifying nothing" cat_magic("{'[ ,]+'split, upper.first, fill.center, q, '\n'collapse ? life}") # fixing the length and filling with 0s string_magic("{'5|0'fill.right, enum ? c(1, 55)}") ## ----------------------------------------------------------------------------- string_magic("y = {'x'paste, ' + 'collapse ? 1:3}") ## ----------------------------------------------------------------------------- string_magic("y = {'x|0'paste, ' + 'collapse ? 1:3}") ## ----------------------------------------------------------------------------- sun = "The sun \\ is shining." string_magic("How is the sun? {join ? sun}") ## ----------------------------------------------------------------------------- input = "yes \n\n no" msg = string_magic("Your input, equal to {escape, bq ? input} is incorrect.") cat(msg, sep = "\n") ## ----------------------------------------------------------------------------- x = c(5, "six") cat_magic(" origin: {enum, q ? x}", " num: {num, enum, q ? x}", " num.rm: {num.rm, enum, q ? x}", " num.soft: {num.soft, enum, q ? x}", "num.clear: {num.clear, enum, q ? x}", .sep = "\n") ## ----------------------------------------------------------------------------- string_magic("{enum ? 1:5}") ## ----------------------------------------------------------------------------- x = c("Marv", "Nancy") string_magic("The murderer must be {enum.or ? x}.") x = c("oranges", "milk", "rice") string_magic("Shopping list: {enum.i.q ? x}.") # enum is made for display: when vectors are too long, they are truncated # default is at 7 x = string_magic("x{sample(100, 30)}") string_magic("The problematic variables are {'x'sort.num, enum ? x}.") # you can augment or reduce the numbers to display with an option string_magic("The problematic variables are {'x'sort.num, enum.3 ? x}.") ## ----------------------------------------------------------------------------- cat_magic("The length of 1:5000:", " - len = {len ? 1:5000}", " - len.num = {len.num ? 1:5000}", .sep = " \n") ## ----------------------------------------------------------------------------- string_magic("Its size is {Len ? 1:8}") ## ----------------------------------------------------------------------------- x = "this is a long sentence" cat_magic("------ version 0 ------\n{x}", "------ version 1 ------\n{15 swidth ? x}", "------ version 2 ------\n{'15|#>'swidth ? x}", "------ version 3 ------\n{'15|#>_'swidth ? x}", .sep = "\n") ## ----------------------------------------------------------------------------- x = Sys.time() Sys.sleep(0.15) string_magic("Time: {difftime ? x}")